Directions:
Answer the following questions about Brasil Brasil
1. What is samba’s geographic, religious, cultural origin?
2. The subject gives us insight into the intersections of race, class, and music that produced various styles of samba in the twentieth century. Briefly describe the samba styles below using information from the subject (include important people, place, events, race/class)
a. Samba Carioca
b. Samba Canção
c. Bossa Nova
3. Again using information from the film, describe what the below terms are:
a. Candomblé
b. Favelas
c. Escolas de Samba (Samba Schools)
View of Origin of the universe:Sikhism-Which of Sikhism's 5 K's intrigues the most and why?
RELIGION:
Sikhism
Discuss the following
Cosmogony – View of Origin of the universe:
View of the Nature of the Sacred (i.e., of “God,” “Ultimate Reality,” “gods,” “spirits,” “forces, … whatever term it uses):
:
View of Human Nature; Understanding of Humanity:
:
View of Good /Evil, Right/Wrong; Morality; Key Values:
:
View of “Salvation,” “Fulfillment,” “Attainment of Life’s Purpose”:
:
View of death and “afterlife” (if any):
:
Key Practices and Rituals:
:
Celebrations and Festivals:
:
Which of Sikhism’s 5 K’s intrigues the most and why?
What core value of Sikhism does that “K” express? Is that value something that YOU view as important?
Why or why not?
Is there another religion we’ve encountered this quarter that has either a similar practice to the “K” you have selected, or a similar core value which it maintains (although perhaps with a radically different symbolic representation or practice)?
To what extent do Vygotsky’s concepts (guided participation, language mediation, apprenticeship, zone of proximal development
After completing the reading assignments for the week answer the following question:Think about an experience in which you learned something that was initially difficult. To what extent do Vygotsky’s concepts (guided participation, language mediation, apprenticeship, zone of proximal development) explain the experience? Write a detailed, step-by-step account of your learning process as Vygotsky would have described it
Assignment Requirements: This journal assignment needs to be written in essay format that includes an Introduction, Body and Conclusion, remembering that 1-2 sentence paragraph isn’t sufficient.
Reticular formation-analyze the roles of nature and nurture in shaping the people
In this assignment, you will take a retrospective look at your life history.
First, choose an area of the brain and explain what it does, as well as how it would impact an activity from your daily life.
Then, analyze the roles of nature and nurture in shaping the person you are today.
Next, describe the influences of culture, environment, and biology on your gender-role behavior. Subsequently, discuss possible sources of inaccuracy and bias in any retrospective analysis.
Finally, discuss the reasons why systematic scientific studies are considered more valuable than individual accounts
Write a three to four (3-4) page paper in which you:
Section 1
- Choose one of the following areas of your brain and explain what it does:
- Thalamus
- Reticular formation
- Brain stem (pons and medulla)
- Cerebellum
- Limbic system
- One of the four lobes of the cerebral cortex
- Explain how the area you described contributes to a specific activity from your everyday life. (Example: During horseback riding, the cerebellum integrates information from the motor systems and balance system.)
Section 2
All of us have been shaped by both nature (biology) and nurture (environment), making us the persons we are today. In most cases, it is difficult to completely disentangle the separate effects of nature vs. nurture with much certainty. However, we can make some educated guesses based on our knowledge of familial tendencies that we may have inherited, as well as knowledge of our environment and experiences. In this section, we ask for you to make some educated guesses about the roles of nature and nurture in your life.
- Describe the role of nature (biology) in shaping what kind of person you are today. Provide a specific example of the role of nature.
- Describe the role of nurture (environment) in shaping what kind of person you are today. Provide a specific example of the role of nurture.
Section 3
- Describe the influences of culture, your environment, and biology on your gender role behavior.
- Use specific examples from your own life to explain your answers.
Section 4
- Discuss the fallibility of memory in terms of bias and inaccuracy when you reflect on your past.
- Identify specific memory biases that could affect how you remember your past. Include factors related to cognition.
- Use specific examples from your own life.
Section
- Describe why the science of psychology places more emphasis on results based on scientific studies than it does on personal experiences and anecdotes.
Your assignment must follow these formatting requirements:
- Be typed, double spaced, using Times New Roman font (size 12), with one-inch margins on all sides; references must follow APA or school-specific format. Check with your professor for any additional instructions.
- To keep this essay short and manageable, your only sources for your paper should be your own experience and the Webtext. For this reason, APA citations and references are not required for this assignment.
- Include a cover page containing the title of the assignment, the student’s name, the professor’s name, the course title, and the date. The cover page and the reference page are not included in the required page length.
The specific course learning outcomes associated with this assignment are:
- Relate psychological concepts to real-world situations.
- Describe the major theories of personality development, learning, memory, cognition, consciousness, development and social psychology.
- Use technology and information resources to research issues in psychology.
- Write clearly and concisely about psychology using proper writing mechanics.
The American Psychological Association Ethical Principles of Psychologists and Code of Conduct: comparing and contrasting the ethical codes
Write a 750-1,000-word essay comparing and contrasting the ethical codes of the following organizations:
- The American Association of Christian Counselors Code of Ethics
- The American Psychological Association Ethical Principles of Psychologists and Code of Conduct
- The American Counseling Association Code of Ethics and Standards of Practice
Discuss the similarities and differences in the policies, in addition to how the guidelines can be applied to working with culturally diverse clients in a behavioral health agency.
Your paper must include at least three credible resources.
on Immigration and how being a immigrant can affect your heath.
in this paper I want you to mention that immigration affects peoples mental health because they always have to be scared of getting deported and having to hold secrets
and also affects your health because when you are an illegal immigrant you cant get health insurance and ect.
Classical conditioning
Classical conditioning is an important theory of learning within the behavioral perspective of learning that you explored in Module 1. The key to classical conditioning is that we learn through association, which is quite different from operant conditioning in which we learn through consequence.
When Ivan Pavlov was studying the process of salivation in dogs, he made an accidental, but really important discovery—classical conditioning. He discovered that after pairing the appearance of the researcher with the delivery of food a number of times, the dogs began to salivate as soon as the researcher walked into the room even when he or she was not carrying any food.
Here is a list of the steps of the classically conditioned learning process:
Stimulus / Response
Event
Outcome
Neutral stimulus (NS)The researcher enters the room—prior to the dog learning that the researcher is associated with food.There is no response.Unconditioned stimulus (UCS)Food—the dog naturally responds to the food.
No learning needed.
Unconditioned response (UCR)The dog salivates because of the food.The dog did not need to be taught to salivate.Conditioned stimulus (CS)The researcher enters the room.Now, after being paired with the food, the appearance of the researcher has become a learned stimulus.Conditioned response (CR)Salivation now occurs because of the researcher.The dog has now learned to salivate in response to the mere presence of the researcher.
Here is another example of the steps of the classical conditioning process:
You have moved into a new apartment building. The first time you take a shower happens to correspond with the time when someone flushes the toilet. As a result of this flushing, the water in the shower becomes very hot. Now, because of this experience, each time you hear the toilet flush, you jump out of the shower before the temperature of the water changes.
- NS: Sound of the flushing of the toilet
- UCS: Hot water
- UCR: Jumping out of the shower because of the hot water
- CS: Sound of the flushing of the toilet
- CR: Jumping out of the shower because of the sound of the flushing toilet
Now, complete the following:
Part 1
Think of a classically conditioned response you have experienced and describe the process of learning this response (what was the process you went through in becoming classically conditioned in this response). Be sure to identify the following:
- Neutral stimulus (NS)
- Unconditional stimulus (UCS)
- Unconditional response (UCR)
- Conditioned stimulus (CS)
- Conditioned response (CR)
Part 2
Address the following questions:
- Describe a practical application that demonstrates this classically conditioned association from your own life. What function does this classically conditioned association serve?
- Explain what would happen if you no longer responded to this conditioned stimulus.
- Describe the manner in which generalization works to maintain classical conditioning.
- Identify the stimulus that has been generalized or could be generalized in your classically conditioned response.
Write a 2–3-page paper in Word format. Apply APA standards to citation of sources. Be sure to also include a title page and a reference page. Use the following file naming convention: LastnameFirstInitial_M2_A2.doc.
By the due date assigned, deliver your assignment to the Submissions Area.
Assignment 2 Grading CriteriaMaximum PointsIdentified an appropriate classically conditioned response and described in detail the process of acquiring the response showing an understanding of the classical conditioning process.12Accurately identified the different steps of the classically conditioned response.8Provided an example of a practical application that demonstrates a classically conditioned association and identified the function served by it.24Explained the purpose of a practical application of a classically conditioned association in your own life, providing details of the effects of not responding to the conditioned stimulus.12Explained the role of generalization in maintaining classical conditioning.12Identified the generalized stimulus in the classically conditioned response identified earlier.12Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources; displayed accurate spelling, grammar, and punctuation.20Total:100
Reinforcement and Punishment
Assignment 2: Reinforcement and Punishment
Social learning theory postulates that gender development is influenced by social environment, which includes the media. An individual’s gender-related behavior is either reinforced or punished during the development period based on the existing social beliefs and standards.
The following assignment will help you examine gender development from the perspective of both boys and girls based on today’s culture and with a look toward future trends.
Using the module readings, the Argosy University online library resources, and the Internet, research social learning theory and gender development during childhood.
Applying the tenets of the social learning theory, explain the role of reinforcement and punishment in gender-related behaviors for boys and girls. Address the following:
- Identify 3–5 examples of gender-related behaviors that are developed through reinforcement or punishment. Be sure to provide a balanced view for boys and girls, and select examples which apply to the development of both boys and girls.
- Explain, in detail, how these behaviors have been shaped by reinforcement and punishment.
- Describe your own experiences with reinforcement and punishment of gender-related behaviors.
- Comment on the following:
- Explain the role of popular culture in the development of reinforcements and punishments.
- Describe what reinforcements and punishments might look like in the future, given current societal trends.
Support your assertions using valid research. Be sure to integrate a reflection of your personal experiences and examples throughout your paper.
Write a 2–3-page paper in Word format. Apply APA standards to the formatting of your paper and the citation of sources. Remember to include a cover page and reference page in APA format. Use the following file naming convention: LastnameFirstInitial_M2_A2.doc.
By the due date assigned, deliver your assignment to the Submissions Area.
Assignment 2 Grading Criteria Maximum PointsExplained the role of reinforcement and punishment in gender-related behaviors for boys and girls.32Provided adequate, valid examples of gender-related behaviors in support of assertions.36Analysis displayed in-depth research and integrated a reflection of personal experiences.12Wrote; demonstrated ethical scholarship in accurate representation and attribution of sources; displayed accurate spelling, grammar, and punctuation.20Total:100
ECO 306 Final Project II-Compare national monetary models in terms of the financial structures of their economies and their process for financial intermediation
ECO 306 Final Project II Guidelines and Rubric
Overview
The final project for this course is the creation of an informative research paper. In the paper, you will compare and contrast the structure and operation of the
central bank of the United States—the Federal Reserve—and the central bank of another country.
This final project will provide an opportunity for you to deepen your understanding of the role of a central bank, or monetary authority. By analyzing the
structure and operation of our domestic central bank, the Federal Reserve, in comparison to a foreign central bank chosen from the list below, you will develop
an understanding and appreciation for the various tools of monetary policy. In doing this, you may learn that the domestic structure is superior or inferior to an
international counterpart, leading to recommendations for potential changes in central bank structure and behavior.
The pre-work for this project is divided into two milestones, which will be submitted at various points throughout the course to scaffold learning and ensure a
quality final submission. These milestones will be submitted in Modules Four and Five. The final project will be submitted in Module Seven.
In this assignment, you will demonstrate your mastery of the following course outcomes:
Compare national monetary models in terms of the financial structures of their economies and their process for financial intermediation
Analyze regulation and conduct of monetary policy for its impact on international and domestic economics
Prompt
In Final Project II, you will write a research paper comparing and contrasting the structure and operation of the central bank of the United States—the Federal
Reserve—and the central bank of another country, chosen from the list below. You will identify the foreign central bank you have chosen, describe its financial
structure, the primary tools it uses to control the money supply, and the role it has in the process of financial intermediation. You will also compare the
macroeconomic conditions in each country and the banking regulations of the two central banks.
Central Bank of Ireland
Central Bank of Iraq
Bank of Canada
Reserve Bank of India
Bank of Japan
Reserve Bank of New Zealand
Central Bank of Syria
Central Bank of Brazil
Central Bank of the Russian Federation
Specifically, the following critical elements must be addressed:
I. Introduction
A. Identify the foreign country you have chosen and explain how its central bank was established.
B. Describe the financial structure of both the central bank you have chosen and the Federal Reserve. Do these central banks operate as
independent entities with monetary autonomy?
C. Describe the process of financial intermediation and what role the central bank you have chosen and the Federal Reserve play in that process.
How do firms borrow and lend, and how do the central banks help facilitate that process?
II. Central Banking: Explain the current macroeconomic conditions (unemployment, inflation, and economic growth [GDP] rates) that the Federal Reserve
and the central bank you have chosen observe in each country, and compare the performance of the two countries.
III. Monetary Policy
A. Explain the primary tools used by the central bank and the Federal Reserve to control the money supply in each country.
B. Describe how each monetary authority uses these tools to impact macroeconomic performance.
C. Compare banking regulations of the central bank you have chosen and the Federal Reserve.
IV. Conclusion: Using your research as a guide, assess the overall performance of each entity. Could one bank learn a lesson from the other?
Milestones
Milestone One: Draft of Introduction
In Module Four, you will submit a 2- to 3-page draft of the Introduction (Section I, above) of the final project. You will identify the foreign country you have
chosen and explain how its central bank was established, its financial structures, as well as the role it plays in the process of financial intermediation. This
milestone will be graded with the Milestone One Rubric.
Milestone Two: Draft of Central Banking and Monetary Policy
In Module Five, you will submit a 3- to 4-page draft of the Central Banking (Section II) and Monetary Policy (Section III) sections of this paper. You will explain the
current macroeconomic conditions in each country and compare their performance. You will also examine each central bank’s monetary policy performance.
This milestone will be graded with the Milestone Two Rubric.
Final Submission: Research Paper
In Module Seven, you will submit your final research paper. It should be a complete, polished artifact containing all of the critical elements of the final product,
including the Conclusion (Section IV). It should reflect the incorporation of feedback gained throughout the course. This submission will be graded with the Final
Project II Rubric.
Final Project II Rubric
Guidelines for Submission: Your paper should be 5 to 7 pages, double-spaced, include one-inch margins, use 12-point Times New Roman font, and adhere to the
latest edition of APA formatting.
Critical Elements Exemplary (100%) Proficient (85%) Needs Improvement (55%) Not Evident (0%) Value
Introduction: Identify Meets “Proficient” criteria and
explanation shows in-depth
knowledge of the
establishment of a central bank
Identifies the foreign country
chosen and explains how its
central bank was established
Identifies the foreign country
chosen and explains how its
central bank was established,
but explanation is illogical or
incomplete
Does not identify the foreign
country chosen or explain how
its central bank was established
4
Introduction:
Financial Structure
Meets “Proficient” criteria and
description demonstrates a
nuanced understanding of the
financial structures of both
banks
Describes the financial
structure of the central bank
chosen and the Federal Reserve
Describes the financial
structure of the central bank
chosen and the Federal
Reserve, but description
contains inaccuracies or gaps
Does not describe the financial
structure of the central bank
chosen and the Federal Reserve
16
Introduction:
Financial
Intermediation
Meets “Proficient” criteria and
description demonstrates a
nuanced understanding of the
role of the banks in the process
of financial intermediation
Describes the process of
financial intermediation and
what role the central bank and
the Federal Reserve play in that
process
Describes the process of
financial intermediation and
what role the central bank and
the Federal Reserve play in that
process, but description is
cursory or incomplete
Does not describe the process
of financial intermediation and
what role the central bank and
the Federal Reserve play in that
process
16
Central Banking Meets “Proficient” criteria and
comparison demonstrates a
sophisticated awareness of
how macroeconomic conditions
relate to economic
performance
Explains the current
macroeconomic conditions in
each country and compares
performance of the two
countries
Explains the current
macroeconomic conditions in
each country and compares
performance of the two
countries, but explanation
contains gaps or comparison is
cursory
Does not explain the current
macroeconomic conditions in
each country or compare
performance of the two
countries
11
Monetary Policy:
Primary Tools
Meets “Proficient” criteria and
explanation demonstrates a
complex grasp of how primary
tools are used to control money
supplies
Explains the primary tools used
by the central bank and the
Federal Reserve to control the
money supply in each country
Explains the primary tools used
by the central bank and the
Federal Reserve to control the
money supply in each country,
but explanation is missing
components or illogical
Does not explain the primary
tools used by the central bank
and the Federal Reserve to
control the money supply in
each country
11
Monetary Policy:
Impact
Meets “Proficient” criteria and
description demonstrates a
sophisticated awareness of the
impact of primary tools on
macroeconomic performance
Describes how each monetary
authority uses its primary tools
to impact macroeconomic
performance
Describes how each monetary
authority uses its primary tools
to impact macroeconomic
performance, but description is
incomplete or contains
inaccuracies
Does not describe how each
monetary authority uses its
primary tools to impact
macroeconomic performance
11
Monetary Policy:
Regulations
Meets “Proficient” criteria and
comparison demonstrates a
complex grasp of banking
regulations
Compares banking regulations
of the central bank and the
Federal Reserve
Compares banking regulations
of the central bank and the
Federal Reserve, but
comparison is cursory or
contains inaccuracies
Does not compare banking
regulations of the central bank
and the Federal Reserve
11
Conclusion Meets “Proficient” criteria and
assessment demonstrates a
nuanced understanding of what
considerations are used to
measure the overall
performance of each entity
Assesses the overall
performance of each entity,
using research as a guide
Assesses the overall
performance of each entity,
using research as a guide, but
assessment is cursory or
illogical
Does not assess the overall
performance of each entity
16
Articulation of
Response
Submission is free of errors
related to citations, grammar,
spelling, syntax, and
organization and is presented
in a professional and easy-toread
format
Submission has no major errors
related to citations, grammar,
spelling, syntax, or organization
Submission has major errors
related to citations, grammar,
spelling, syntax, or organization
that negatively impact
readability and articulation of
main ideas
Submission has critical errors
related to citations, grammar,
spelling, syntax, or organization
that prevent understanding of
ideas
4
Total 100%
Biology 351- Homework Assignment: Does RNA polymerase holoenzyme recognize the sense, or antisense strand? The antisense strand is used for what purpose during transcription?
Name: _________________________
Biology 351- Homework Assignment #5 (10 points)
This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department.
- During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?
- A single strand of bacterial DNA contains the base sequence
-35 -10 +1
5’ CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3’
- What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.
- Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.
- Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.
- If a stop codon is not included in the mRNA molecule, how would this affect the following:
- translocation on the mRNA by polyribosomes
- concentration of this specific polypeptide in the cell
- How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?
analyzing the anthropology implicit in a text of your choice from contemporary culture, and comparing that anthropology with Christian views studied in this course
Objectives
Deeply held beliefs influence every aspect of life, even when they are not clearly related to religion. This course helps you to become more literate in a major theological tradition (Christianity), and more aware of the ways that core beliefs play out in everyday life. This paper asks you to examine beliefs about the human person found in an everyday item of your choice, and to discern how those beliefs are similar to, or different from, the beliefs studied in this course. This paper focuses on identifying beliefs when they are expressed in non-theological language, and comparing those expressions to Christian theological tradition as studied in this course, noting similarities and differences.
Directions
Write a 4-5 page paper (1000-1250 words) analyzing the anthropology implicit in a text of your choice from contemporary culture, and comparing that anthropology with Christian views studied in this course. Possibilities for a text include (but are not limited to):
- Music or music videos
- Comics, video games, movies, TV shows
- Social media: Facebook, Instagram, Twitter, or any format that allows a user to develop their views in public (such as in a series of tweets or posts)
- News items or editorials about contemporary events, e.g., #MeToo, deportation of undocumented immigrants, Black Lives Matter, etc.
- Articles on new technologies in society and how they affect us
- Advertisements (TV, radio, internet)
- Articles on genetic engineering, euthanasia, physician-assisted suicide, or other life issues
- Marketing strategies from articles in business textbooks or journals
- Items from self-help literature
- Paintings, sculpture, theater, dance
Because you will compare and contrast the text with Christian views (see below), look for texts that are not from an obviously Christian point of view. Look also for texts that will give you a lot to work with. If you are not sure if your choice is appropriate, please run it past me soon.
What does “anthropology” mean? In this context, it means the view of human beings found in the text. “Implicit” indicates that the text most likely will not come right out and say “Here’s how we view the human person…” You will have to look beneath the surface of the text.
Analyze how the text views the following questions of anthropology:
- What is the origin of the human person? Do we invent ourselves?
- Is the person essentially an individual or essentially related to others? How are strangers or enemies regarded?
- What are human limits (e.g., the fact that we die or can’t do some things)? Are such limits positive or negative?
- Are all humans equal?
- Are humans free, or do larger forces determine our fate?
- Are humans by nature good or bad? Does the text lean toward a more positive/upbeat or more negative/pessimistic view of human nature?
- What is the purpose of human life – why are we here?
Not every text will address every one of these questions, but try to find a text that will be relevant to several of them. Choose TWO of these questions, briefly compare and contrast Christian anthropology with the anthropology of your chosen item. Use Genesis, Aquinas, Himes, “Testament of a Murdered Monk,” Tanner and the ICT textbook to support your analysis. Be sure to cite your sources accurately.
How will you be graded? Check out the rubric here
Suggestions and Guidelines for writing papers in THEO 200
- Decide what your main point or insight is (thesis). Once you know this, you can organize the evidence and arguments that lead to your conclusion.
- As you look more closely at your chosen text and the course readings, you may decide to revise your thesis.
- Write your introduction and conclusion last.
- It is better to summarize a point from the readings than to quote extensively. Keep quotes short. If quotes are over 40 words, they should be in the form of a block quotation: separate paragraph, single spaced, slightly indented.
- Whether you paraphrase or quote a source, cite the author and page number. For Thomas Aquinas, cite the part of the article you are using like this: (Aquinas, I. 83.1, obj. 1), or (Aquinas I. 83.1, answer), or (Aquinas, I. 83.1, reply 3). For Genesis, cite chapter and verse like this: (Gen 1:28).
